| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:131644_023-XXXXX-006_Porifera_Poecilosclerida_Cladorhizidae___tRNA-Phe |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Cladorhizidae (Dendy 1922) |
| Dna sequence | ATTCAAATAGCTCAATCGGTAGAGCGAAACACTGAAAATGTTTGGGTTCCGGGTT |
| Phylum | Porifera |
| Gene | tRNA-Phe |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Demospongiae |
| Order | Poecilosclerida |
| Family | Cladorhizidae |
| Genus | N/A |
| Specific epithet | N/A |
| Intraspecific epithet | N/A |
| Taxon rank | Family |
| Scientific name id | urn:lsid:marinespecies.org:taxname:131644 |
| Decimal latitude | 49.7580875 |
| Decimal longitude | -130.2574353 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-006 |
| Preparations | N/A |
| Date identified | 2023 |
| Identification remarks | BLAST 80%+ match to multiple genera in Cladorhizidae |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Old Area |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1796.33 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Phenylalanine |
| Haplotype | N/A |
| Transl table | Invertebrate Mitochondrial (trans_table=5) |
| Codon start | N/A |
| Location | 1:55 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |