urn:lsid:marinespecies.org:taxname:1360_023-XXXXX-027_Cnidaria_Actiniaria____CR - Fisheries Oceans

Back to Results

Individual Record Page
Occurrence id	urn:lsid:marinespecies.org:taxname:1360_023-XXXXX-027_Cnidaria_Actiniaria____CR
Occurrence status	present
Basis of record	PreservedSpecimen
Scientific name	Actiniaria
Dna sequence	TGGAATGGATGTTGACACAAGAGCCTACTTCACTGCAGCTACTATGATTATAGCTGTTCCAACTGGAATTAAGGTGTTTAGTTGGTTGGCCACTATTTACGGTGGAGCCGTTAGACTAGATACACCTATGCTTTGGGCCATAGGGTTTGTTTTCCTTTTTACAATAGGAGGTCTAACCGGGGTTATTTTAGCAAATAGTTCCTTAGATGTTGTATTACACGACACTTACTATGTAGTAGCTCATTTCCATTATGTCCTATCAATGGGAGCTGTTTTTGCCATCTTTGCTGGGTTCTATTATTGGTTTGGGAAAATTACTGGCTATTGCTACAATGAGCTTTATGGTAAAATCCACTTTTGGTTGATGTTTATTGGGGTTAATTTAACATTTTTCCCTCAGCATTTCTTAGGTTTAGCTGGATTCCCAAGACGATACTCTGATTTCGTTGAT
Phylum	Cnidaria
Gene	CR
Day	N/A
Month	May
Year	2023
Kingdom	Animalia
Class	Hexacorallia
Order	Actiniaria
Family	N/A
Genus	N/A
Specific epithet	N/A
Intraspecific epithet	N/A
Taxon rank	Order
Scientific name id	urn:lsid:marinespecies.org:taxname:1360
Decimal latitude	49.0459127
Decimal longitude	-127.2541032
Organism id	N/A
Collection code	N/A
Collection id	N/A
Institution code	RBCM
Institution id	N/A
Catalog number	023-XXXXX-027
Preparations	N/A
Date identified	2023
Identification remarks	N/A
Identified by	Heidi Gartner
Country	Canada
Country code	CA
County	N/A
Locality	Hesquiaht Slope Cold Seeps
Location according to	Cherisse DuPreez
Maximum depth in meters	N/A
Minimum depth in meters	N/A
Municipality	N/A
State province	British Columbia
Verbatim depth	1567.56
Water body	Eastern North Pacific Ocean
Genbank accession number	N/A
Product	control region
Haplotype	N/A
Transl table	N/A
Codon start	N/A
Location	3970:4254
Strand	plus
Pcr primer forward	N/A
Pcr primer name forward	N/A
Pcr primer name reverse	N/A
Pcr primer reference	N/A
Pcr primer reverse	N/A
Seq meth	Illumina