| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:152391_023-XXXXX-004_Nemertea_____tRNA-Ser |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Nemertea |
| Dna sequence | GAAGTAACTTATGGAATTATGGCTGCTAACTGTGATTTGAGTAGGTAGGACTATTCTTGCTTTT |
| Phylum | Nemertea |
| Gene | tRNA-Ser |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | N/A |
| Order | N/A |
| Family | N/A |
| Genus | N/A |
| Specific epithet | N/A |
| Intraspecific epithet | N/A |
| Taxon rank | Phylum |
| Scientific name id | urn:lsid:marinespecies.org:taxname:152391 |
| Decimal latitude | 49.7600792 |
| Decimal longitude | -130.255983 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-004 |
| Preparations | N/A |
| Date identified | 2024 |
| Identification remarks | Potential Nemertea. Closest BLAST similarity with Nemertea at 80% |
| Identified by | Kristen Westfall |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Record Breaker Hydrothermal Vent |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1797.11 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Serine |
| Haplotype | N/A |
| Transl table | Invertebrate Mitochondrial (trans_table=5) |
| Codon start | N/A |
| Location | 2576:2639 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |
