| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:1608733_023-XXXXX-001_Cnidaria_Malacalcyonacea_Gorgoniidae_Callistephanus_simplex_tRNA-Met |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Callistephanus simplex (Nutting 1909) |
| Dna sequence | TGTAGGGTCAACTAACGGTAAGTTCTCAGACTCATAATCTGATTATGCAGGTTCAACTCCTGCCCCTACCA |
| Phylum | Cnidaria |
| Gene | tRNA-Met |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Octocorallia |
| Order | Malacalcyonacea |
| Family | Gorgoniidae |
| Genus | Callistephanus |
| Specific epithet | simplex |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:1608733 |
| Decimal latitude | 49.0609083 |
| Decimal longitude | -130.9439005 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-001 |
| Preparations | N/A |
| Date identified | 2024 |
| Identification remarks | N/A |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Explorer Seamount |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 939.85 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Methionine |
| Haplotype | N/A |
| Transl table | Invertebrate Mitochondrial (trans_table=5) |
| Codon start | N/A |
| Location | 10140:10070 |
| Strand | minus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |
