Individual Record Page |
---|
Occurrence id | urn:lsid:marinespecies.org:taxname:180858_023-XXXXX-028_Mollusca__Neolepetopsidae_Paralepetopsis__tRNA-Tyr |
Occurrence status | present |
Basis of record | PreservedSpecimen |
Scientific name | Paralepetopsis (JH McLean 1990) |
Dna sequence | TAAGGGGTGGCTGAATAAAGCAATAGACTGTAAATCTAGATATGAGGATCCCGCTCCCTCCCTCTTAA |
Phylum | Mollusca |
Gene | tRNA-Tyr |
Day | N/A |
Month | May |
Year | 2023 |
Kingdom | Animalia |
Class | Gastropoda |
Order | N/A |
Family | Neolepetopsidae |
Genus | Paralepetopsis |
Specific epithet | N/A |
Intraspecific epithet | N/A |
Taxon rank | Genus |
Scientific name id | urn:lsid:marinespecies.org:taxname:180858 |
Decimal latitude | 49.0459093 |
Decimal longitude | -127.2540901 |
Organism id | N/A |
Collection code | N/A |
Collection id | N/A |
Institution code | RBCM |
Institution id | N/A |
Catalog number | 023-XXXXX-028 |
Preparations | N/A |
Date identified | 2023 |
Identification remarks | COI BLAST 95% similar to Paralepetopsis sp. (GB Acc. KY581541) |
Identified by | Heidi Gartner |
Country | Canada |
Country code | CA |
County | N/A |
Locality | Hesquiaht Slope Cold Seeps |
Location according to | Cherisse DuPreez |
Maximum depth in meters | N/A |
Minimum depth in meters | N/A |
Municipality | N/A |
State province | British Columbia |
Verbatim depth | 1567.38 |
Water body | Eastern North Pacific Ocean |
Genbank accession number | N/A |
Product | transfer RNA Tyrosine |
Haplotype | N/A |
Transl table | N/A |
Codon start | N/A |
Location | 16617:16684 |
Strand | plus |
Pcr primer forward | N/A |
Pcr primer name forward | N/A |
Pcr primer name reverse | N/A |
Pcr primer reference | N/A |
Pcr primer reverse | N/A |
Seq meth | Illumina |