| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:254775_023-XXXXX-018_Echinodermata_Forcipulatida_Zoroasteridae_Sagenaster_evermanni_tRNA-Gly |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Sagenaster evermanni (Fisher 1905) |
| Dna sequence | ATTTCATAAGTATAGTAGTATATTTGATTTCCAATCAAAAGGTTTTTGTTAATAATCAGAAATGGGATA |
| Phylum | Echinodermata |
| Gene | tRNA-Gly |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Asteroidea |
| Order | Forcipulatida |
| Family | Zoroasteridae |
| Genus | Sagenaster |
| Specific epithet | evermanni |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:254775 |
| Decimal latitude | 50.0264793 |
| Decimal longitude | -128.6324701 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-018 |
| Preparations | N/A |
| Date identified | 2024 |
| Identification remarks | BLAST 100% similarity (COI) with species |
| Identified by | Heidi Gartner / Kristen Westfall |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Twin Flares |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1494.24 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Glycine |
| Haplotype | N/A |
| Transl table | N/A |
| Codon start | N/A |
| Location | 1302:1234 |
| Strand | minus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |