Individual Record Page |
---|
Occurrence id | urn:lsid:marinespecies.org:taxname:254775_023-XXXXX-018_Echinodermata_Forcipulatida_Zoroasteridae_Sagenaster_evermanni_tRNA-Lys |
Occurrence status | present |
Basis of record | PreservedSpecimen |
Scientific name | Sagenaster evermanni (Fisher 1905) |
Dna sequence | CTTTGATAAGCTTATATAGGCAAGCATTAAACTCTTAATTTAAATCAAAGTGATCTACCACCCACTATCAAAGA |
Phylum | Echinodermata |
Gene | tRNA-Lys |
Day | N/A |
Month | May |
Year | 2023 |
Kingdom | Animalia |
Class | Asteroidea |
Order | Forcipulatida |
Family | Zoroasteridae |
Genus | Sagenaster |
Specific epithet | evermanni |
Intraspecific epithet | N/A |
Taxon rank | species |
Scientific name id | urn:lsid:marinespecies.org:taxname:254775 |
Decimal latitude | 50.0264793 |
Decimal longitude | -128.6324701 |
Organism id | N/A |
Collection code | N/A |
Collection id | N/A |
Institution code | RBCM |
Institution id | N/A |
Catalog number | 023-XXXXX-018 |
Preparations | N/A |
Date identified | 2024 |
Identification remarks | BLAST 100% similarity (COI) with species |
Identified by | Heidi Gartner / Kristen Westfall |
Country | Canada |
Country code | CA |
County | N/A |
Locality | Twin Flares |
Location according to | Cherisse DuPreez |
Maximum depth in meters | N/A |
Minimum depth in meters | N/A |
Municipality | N/A |
State province | British Columbia |
Verbatim depth | 1494.24 |
Water body | Eastern North Pacific Ocean |
Genbank accession number | N/A |
Product | transfer RNA Lysine |
Haplotype | N/A |
Transl table | N/A |
Codon start | N/A |
Location | 4776:4849 |
Strand | plus |
Pcr primer forward | N/A |
Pcr primer name forward | N/A |
Pcr primer name reverse | N/A |
Pcr primer reference | N/A |
Pcr primer reverse | N/A |
Seq meth | Illumina |