| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:266009_023-XXXXX-002_Annelida_Sabellida_Siboglinidae_Ridgeia_piscesae_tRNA-Cys |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Ridgeia piscesae (Jones 1985) |
| Dna sequence | AACCTTATAGTTGAATCTACAACATTAAATTGCAGCTTTAAAAGTGTATCCTTACTAAGGTTT |
| Phylum | Annelida |
| Gene | tRNA-Cys |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Polychaeta |
| Order | Sabellida |
| Family | Siboglinidae |
| Genus | Ridgeia |
| Specific epithet | piscesae |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:266009 |
| Decimal latitude | 49.7597477 |
| Decimal longitude | -130.2562619 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-002 |
| Preparations | N/A |
| Date identified | 2024 |
| Identification remarks | Identified to Family level from morphology and species level from BLAST similarity (NCBI Reference Sequence: NC_024653.1) |
| Identified by | Heidi Gartner / Kristen Westfall |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Record Breaker Hydrothermal Vent |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1807.92 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Cysteine |
| Haplotype | N/A |
| Transl table | Invertebrate Mitochondrial (trans_table=5) |
| Codon start | N/A |
| Location | 1908:1970 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |