Individual Record Page |
---|
Occurrence id | urn:lsid:marinespecies.org:taxname:266009_023-XXXXX-002_Annelida_Sabellida_Siboglinidae_Ridgeia_piscesae_tRNA-Cys |
Occurrence status | present |
Basis of record | PreservedSpecimen |
Scientific name | Ridgeia piscesae (Jones 1985) |
Dna sequence | AACCTTATAGTTGAATCTACAACATTAAATTGCAGCTTTAAAAGTGTATCCTTACTAAGGTTT |
Phylum | Annelida |
Gene | tRNA-Cys |
Day | N/A |
Month | May |
Year | 2023 |
Kingdom | Animalia |
Class | Polychaeta |
Order | Sabellida |
Family | Siboglinidae |
Genus | Ridgeia |
Specific epithet | piscesae |
Intraspecific epithet | N/A |
Taxon rank | species |
Scientific name id | urn:lsid:marinespecies.org:taxname:266009 |
Decimal latitude | 49.7597477 |
Decimal longitude | -130.2562619 |
Organism id | N/A |
Collection code | N/A |
Collection id | N/A |
Institution code | RBCM |
Institution id | N/A |
Catalog number | 023-XXXXX-002 |
Preparations | N/A |
Date identified | 2024 |
Identification remarks | Identified to Family level from morphology and species level from BLAST similarity (NCBI Reference Sequence: NC_024653.1) |
Identified by | Heidi Gartner / Kristen Westfall |
Country | Canada |
Country code | CA |
County | N/A |
Locality | Record Breaker Hydrothermal Vent |
Location according to | Cherisse DuPreez |
Maximum depth in meters | N/A |
Minimum depth in meters | N/A |
Municipality | N/A |
State province | British Columbia |
Verbatim depth | 1807.92 |
Water body | Eastern North Pacific Ocean |
Genbank accession number | N/A |
Product | transfer RNA Cysteine |
Haplotype | N/A |
Transl table | Invertebrate Mitochondrial (trans_table=5) |
Codon start | N/A |
Location | 1908:1970 |
Strand | plus |
Pcr primer forward | N/A |
Pcr primer name forward | N/A |
Pcr primer name reverse | N/A |
Pcr primer reference | N/A |
Pcr primer reverse | N/A |
Seq meth | Illumina |