Record Page
| Individual Record Page | |
|---|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:267936_023-XXXXX-024_Cnidaria_Scleralcyonacea_Schizopathidae _Umbellapathes__tRNA-Trp |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Umbellapathes (Opresko 2005) |
| Dna sequence | AGGAGGTTAGGTTAAGGAAGACCGTTAGCCTTCAAAGCTAAAAGTGTGGGTTCAAGTCCTGCCCCTCCTG |
| Phylum | Cnidaria |
| Gene | tRNA-Trp |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Hexacorallia |
| Order | Scleralcyonacea |
| Family | Schizopathidae |
| Genus | Umbellapathes |
| Specific epithet | N/A |
| Intraspecific epithet | N/A |
| Taxon rank | Genus |
| Scientific name id | urn:lsid:marinespecies.org:taxname:267936 |
| Decimal latitude | 48.9412922 |
| Decimal longitude | -130.5449051 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-024 |
| Preparations | N/A |
| Date identified | 2023 |
| Identification remarks | N/A |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | NEPDEP35 |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 3012.23 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Tryptophan |
| Haplotype | N/A |
| Transl table | N/A |
| Codon start | N/A |
| Location | 8160:8229 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |