| Individual Record Page | |
|---|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:286728_023-XXXXX-014_Cnidaria_Scleratinia_Caryophyllidae_Caryophyllia_arnoldi_tRNA-Met |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Caryophyllia arnoldi )Vaughan 1900) |
| Dna sequence | TGTAAGAAAGACTAAGGGTAAGTCGTCGGGCTCATGCCCCGAAAAAGGGAGTTCAAGTCTCGCTCTTACAA |
| Phylum | Cnidaria |
| Gene | tRNA-Met |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Hexacorallia |
| Order | Scleratinia |
| Family | Caryophyllidae |
| Genus | Caryophyllia |
| Specific epithet | arnoldi |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:286728 |
| Decimal latitude | 51.4029723 |
| Decimal longitude | -131.01187 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-014 |
| Preparations | N/A |
| Date identified | 2023 |
| Identification remarks | N/A |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Tuzo Wilson Seamount |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1608.38 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Methionine |
| Haplotype | N/A |
| Transl table | N/A |
| Codon start | N/A |
| Location | 1:71 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |