| Individual Record Page | |
|---|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:413442_023-XXXXX-022_Mollusca_Neomphalida_Peltospiridae_Depressigyra_globulus_tRNA-Lys |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Depressigyra globulus (Warén & Bouchet 1989) |
| Dna sequence | CTTCAGATGGCTGAGAATAAGCAATAGATTTTTAATCTGTTCACGATAGAAATTATCTCTGAAGA |
| Phylum | Mollusca |
| Gene | tRNA-Lys |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Gastropoda |
| Order | Neomphalida |
| Family | Peltospiridae |
| Genus | Depressigyra |
| Specific epithet | globulus |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:413442 |
| Decimal latitude | 49.7597291 |
| Decimal longitude | -130.2593768 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-022 |
| Preparations | N/A |
| Date identified | 2023 |
| Identification remarks | N/A |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Explorer Vents |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1767.22 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Lysine |
| Haplotype | N/A |
| Transl table | N/A |
| Codon start | N/A |
| Location | 13020:13084 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |