| Individual Record Page |
|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:449972_023-XXXXX-003_Mollusca_Lepetellida_Lepetodrilidae_Lepetodrilus_fucensis_tRNA-Ile |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Lepetodrilus fucensis (J.H. McLean 1988) |
| Dna sequence | GGTGATGTGCCGGATAAACGGAGTGCGATGATGGTGCAAATCATGAGAAAATTTCTCCTTCACCT |
| Phylum | Mollusca |
| Gene | tRNA-Ile |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Gastropoda |
| Order | Lepetellida |
| Family | Lepetodrilidae |
| Genus | Lepetodrilus |
| Specific epithet | fucensis |
| Intraspecific epithet | N/A |
| Taxon rank | species |
| Scientific name id | urn:lsid:marinespecies.org:taxname:449972 |
| Decimal latitude | 49.7599849 |
| Decimal longitude | -130.2560305 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-003 |
| Preparations | N/A |
| Date identified | 2024 |
| Identification remarks | Identified as limpet from morphology and species level from BLAST similarity of COI to NCBI DQ228006.1 |
| Identified by | Heidi Gartner / Kristen Westfall |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Record Breaker Hydrothermal Vent |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1793.15 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Isoleucine |
| Haplotype | N/A |
| Transl table | Invertebrate Mitochondrial (trans_table=5) |
| Codon start | N/A |
| Location | 5911:5975 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |