Individual Record Page |
---|
Occurrence id | urn:lsid:marinespecies.org:taxname:834674_023-XXXXX-016_Porifera_Lyssacinosida_Rossellidae_Doconesthes_dustinchiversi_tRNA-Phe |
Occurrence status | present |
Basis of record | PreservedSpecimen |
Scientific name | Doconesthes dustinchiversi (Reiswig 2015) |
Dna sequence | GTTCAAGAAACTCAATTTAGAGTAACATTTTGAAAAAATGGACACTACAGGTTTAAATCCTGTCTAGGACA |
Phylum | Porifera |
Gene | tRNA-Phe |
Day | N/A |
Month | May |
Year | 2023 |
Kingdom | Animalia |
Class | Hexactinellida |
Order | Lyssacinosida |
Family | Rossellidae |
Genus | Doconesthes |
Specific epithet | dustinchiversi |
Intraspecific epithet | N/A |
Taxon rank | species |
Scientific name id | urn:lsid:marinespecies.org:taxname:834674 |
Decimal latitude | 51.4020481 |
Decimal longitude | -131.0129013 |
Organism id | N/A |
Collection code | N/A |
Collection id | N/A |
Institution code | RBCM |
Institution id | N/A |
Catalog number | 023-XXXXX-016 |
Preparations | N/A |
Date identified | 2023 |
Identification remarks | BLAST 99% similarity to species |
Identified by | Heidi Gartner / Kristen Westfall |
Country | Canada |
Country code | CA |
County | N/A |
Locality | Tuzo Wilson Seamount |
Location according to | Cherisse DuPreez |
Maximum depth in meters | N/A |
Minimum depth in meters | N/A |
Municipality | N/A |
State province | British Columbia |
Verbatim depth | 1598.54 |
Water body | Eastern North Pacific Ocean |
Genbank accession number | N/A |
Product | transfer RNA Phenylalanine |
Haplotype | N/A |
Transl table | N/A |
Codon start | N/A |
Location | 1:71 |
Strand | plus |
Pcr primer forward | N/A |
Pcr primer name forward | N/A |
Pcr primer name reverse | N/A |
Pcr primer reference | N/A |
Pcr primer reverse | N/A |
Seq meth | Illumina |