Record Page
| Individual Record Page | |
|---|---|
| Occurrence id | urn:lsid:marinespecies.org:taxname:939_023-XXXXX-023_Annelida_Phyllodocida_Polynoidae___tRNA-Asn |
| Occurrence status | present |
| Basis of record | PreservedSpecimen |
| Scientific name | Polynoidae (Kinberg 1856) |
| Dna sequence | TAGGCTGAAGCTAAACAATCAGCATCTAGTTGTTACCTAGAAAACTGTTATAACTATAACCTCCCTAA |
| Phylum | Annelida |
| Gene | tRNA-Asn |
| Day | N/A |
| Month | May |
| Year | 2023 |
| Kingdom | Animalia |
| Class | Polychaeta |
| Order | Phyllodocida |
| Family | Polynoidae |
| Genus | N/A |
| Specific epithet | N/A |
| Intraspecific epithet | N/A |
| Taxon rank | Family |
| Scientific name id | urn:lsid:marinespecies.org:taxname:939 |
| Decimal latitude | 49.7597301 |
| Decimal longitude | -130.2593771 |
| Organism id | N/A |
| Collection code | N/A |
| Collection id | N/A |
| Institution code | RBCM |
| Institution id | N/A |
| Catalog number | 023-XXXXX-023 |
| Preparations | N/A |
| Date identified | 2023 |
| Identification remarks | N/A |
| Identified by | Heidi Gartner |
| Country | Canada |
| Country code | CA |
| County | N/A |
| Locality | Explorer Vents |
| Location according to | Cherisse DuPreez |
| Maximum depth in meters | N/A |
| Minimum depth in meters | N/A |
| Municipality | N/A |
| State province | British Columbia |
| Verbatim depth | 1767.46 |
| Water body | Eastern North Pacific Ocean |
| Genbank accession number | N/A |
| Product | transfer RNA Asparagine |
| Haplotype | N/A |
| Transl table | N/A |
| Codon start | N/A |
| Location | 9275:9342 |
| Strand | plus |
| Pcr primer forward | N/A |
| Pcr primer name forward | N/A |
| Pcr primer name reverse | N/A |
| Pcr primer reference | N/A |
| Pcr primer reverse | N/A |
| Seq meth | Illumina |