Individual Record Page | |
---|---|
Occurrence id | urn:lsid:marinespecies.org:taxname:939_023-XXXXX-024_Annelida_Phyllodocida_Polynoidae___tRNA-Gln |
Occurrence status | present |
Basis of record | PreservedSpecimen |
Scientific name | Polynoidae (Kinberg 1856) |
Dna sequence | TGATTAGATGTGGCTGGCCACAATAGGATTTTGACTCCTATTTCTAAGGTTCGACTCCTTTCTAACCAA |
Phylum | Annelida |
Gene | tRNA-Gln |
Day | N/A |
Month | May |
Year | 2023 |
Kingdom | Animalia |
Class | Polychaeta |
Order | Phyllodocida |
Family | Polynoidae |
Genus | N/A |
Specific epithet | N/A |
Intraspecific epithet | N/A |
Taxon rank | Family |
Scientific name id | urn:lsid:marinespecies.org:taxname:939 |
Decimal latitude | 49.7597301 |
Decimal longitude | -130.2593771 |
Organism id | N/A |
Collection code | N/A |
Collection id | N/A |
Institution code | RBCM |
Institution id | N/A |
Catalog number | 023-XXXXX-023 |
Preparations | N/A |
Date identified | 2023 |
Identification remarks | N/A |
Identified by | Heidi Gartner |
Country | Canada |
Country code | CA |
County | N/A |
Locality | Explorer Vents |
Location according to | Cherisse DuPreez |
Maximum depth in meters | N/A |
Minimum depth in meters | N/A |
Municipality | N/A |
State province | British Columbia |
Verbatim depth | 1767.46 |
Water body | Eastern North Pacific Ocean |
Genbank accession number | N/A |
Product | transfer RNA Glutamine |
Haplotype | N/A |
Transl table | N/A |
Codon start | N/A |
Location | 11097:11165 |
Strand | plus |
Pcr primer forward | N/A |
Pcr primer name forward | N/A |
Pcr primer name reverse | N/A |
Pcr primer reference | N/A |
Pcr primer reverse | N/A |
Seq meth | Illumina |